Filters
Technology
Platform
GSE48655
Rattus norvegicus
8 Downloadable Samples
Affymetrix Rat Gene 1.0 ST Array (ragene10st)
Description
Intrauterine growth restriction is a common complication of pregnancy. We induce IUGR in rats by bilateral uterine artery ligation at e18 of a 23 day gestation.
Publication Title
Neutralizing Th2 inflammation in neonatal islets prevents β-cell failure in adult IUGR rats.
Sample Metadata Fields
Specimen part, Treatment
View Samples- Homo sapiens
- 3 Downloadable Samples
Illumina HiSeq 2500
Description
HeLa cells lacking MORC2 generated through CRISPR/Cas9-mediated gene disruption were reconstituted with either wild-type or R252W mutant MORC2, and re-repression of HUSH target genes assessed by RNA-seq Overall design: Total RNA-seq of MORC2 knockout cells, either 1) mock transduced, 2) transduced with lentiviral vector encoding wild-type MORC2 or 3) transduced with lentviral vector encoding R252W MORC2.
Publication Title
Hyperactivation of HUSH complex function by Charcot-Marie-Tooth disease mutation in MORC2.
Sample Metadata Fields
Cell line, Subject
View Samples- Homo sapiens
- 28 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Human pluripotent stem cells were differentiated into hematopoietic progenitors, which were then re-specified using defined transcription factors to resemble hematopoietic stem cells (HSC)
Publication Title
Induction of multipotential hematopoietic progenitors from human pluripotent stem cells via respecification of lineage-restricted precursors.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 107 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Comparative analysis can provide important insights into complex biological systems. As demonstrated in the accompanying paper, Translating Ribosome Affinity Purification (TRAP), permits comprehensive studies of translated mRNAs in genetically defined cell populations following physiological perturbations.
Publication Title
Application of a translational profiling approach for the comparative analysis of CNS cell types.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 6 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
The PLZF-RARa fusion oncoprotein is overexpressed in the t(11;17) subtype of acute promyelocytic leukemia. Gene expression microarrays were used to identify genes involved in leukemic transformation.
Publication Title
Comprehensive genomic screens identify a role for PLZF-RARalpha as a positive regulator of cell proliferation via direct regulation of c-MYC.
Sample Metadata Fields
Cell line
View Samples- Mus musculus
- 4 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
We developed a mouse line targeting midbrain dopamine neurons for Translating Ribosome Affinity Purification (TRAP). Here, we briefly report on the basic characterization of this mouse line including confirmation of expression of the transgene in midbrain dopamine neurons and validation of its effectiveness in capturing mRNA from these cells. We also report a translational profile of these neurons which may be of use to investigators studying the gene expression of these cells. Finally, we have donated the line to Jackson Laboratories for distribution and use in future studies.
Publication Title
Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.
Sample Metadata Fields
Sex, Specimen part
View Samples- Homo sapiens
- 4 Downloadable Samples
- NextSeq 500
Description
We performed morphogen-directed differentiation of human PSCs into HE followed by combinatorial screening of 26 candidate HSC-specifying TFs for the potential to promote hematopoietic engraftment in irradiated immune deficient murine hosts. We recovered seven TFs (ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1, SPI1) that together were sufficient to convert HE into hematopoietic stem and progenitor cells (HSPCs) that engraft primary and secondary murine recipients Overall design: Examination of expression pattern in hematopoietic cells.
Publication Title
Haematopoietic stem and progenitor cells from human pluripotent stem cells.
Sample Metadata Fields
Specimen part, Subject
View Samples- Homo sapiens
- 18 Downloadable Samples
- IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 8 Downloadable Samples
- Illumina HiSeq 2500
Description
While gene expression dynamics have been extensively catalogued during hematopoietic differentiation in the adult, less is known about transcriptome diversity of human hematopoietic stem cells (HSCs) during development. To characterize transcriptional and post-transcriptional changes in HSCs during development, we leveraged high-throughput genomic approaches to profile miRNAs, lincRNAs, and mRNAs. Our findings indicate that HSCs manifest distinct alternative splicing patterns in key hematopoietic regulators. Detailed analysis of the splicing dynamics and function of one such regulator, HMGA2, identified an alternative isoform that escapes miRNA-mediated targeting. We further identified the splicing kinase CLK3 that, by regulating HMGA2 splicing, preserves HMGA2 function in the setting of an increase in let-7 miRNA levels, delineating how CLK3 and HMGA2 form a functional axis that influences HSC properties during development. Collectively, our study highlights molecular mechanisms by which alternative splicing and miRNA-mediated post-transcriptional regulation impact the molecular identity and stage-specific developmental features of human HSCs. Overall design: RNA-seq of HPC-5F cells transduced with a control (CTRL), HMGA2-L (LONG), HMGA2-S (SHORT) or CLK3 ORF lentiviral over-expression vectors.
Publication Title
A CLK3-HMGA2 Alternative Splicing Axis Impacts Human Hematopoietic Stem Cell Molecular Identity throughout Development.
Sample Metadata Fields
Specimen part, Subject
View Samples- Homo sapiens
- 72 Downloadable Samples
- Illumina HiSeq 2000
Description
The goal of the study was to analyze the principles governing the usage of alternatively spliced transcript isoform of four types of T-cells (Naïve, Central Memory, Transitional Memory and Effector Memory) between resting and activated status. However, the principles discovered in the T cells were universal and can also be applied to other cell type and tissues. Overall design: Four types of T cells were sorted and whole transcriptome analysis was performed using an Illumina machine The readme.txt contains the column headers and description for the processed data files.
Publication Title
Stochastic principles governing alternative splicing of RNA.
Sample Metadata Fields
Subject
View Samples