Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Tunable protein synthesis by transcript isoforms in human cells.
No sample metadata fields
View SamplesRNA expression profiles are not significantly altered by DDX3 WT or R534H expression as well as by 45 minute exposure of cells to sodium arsenite. Overall design: Cells expressing either DDX3 WT or R534H variant were treated with or without sodium arsenite and lysed in the presence of cyclohexime. Total cellular RNAs were extracted and sequenced.
Medulloblastoma-associated DDX3 variant selectively alters the translational response to stress.
No sample metadata fields
View SamplesLong chain fatty acids (LCFA) serve as energy sources, components of cell membranes, and precursors for signalling molecules. Here we show that these important biological compounds also regulate gene expression by controlling the transcriptional activities of the retinoic acid (RA)-activated nuclear receptors RAR and PPAR/. Our data indicates that these activities of LCFA are mediated by FABP5, a protein that delivers ligands from the cytosol to nuclear PPAR/. Both saturated and unsaturated LCFA (SLCFA, ULCFA) tightly bind to FABP5, thereby displacing RA and diverting it to RAR. However, while SLCFA inhibit, ULCFA activate the FABP5/PPAR/ pathway. By concomitantly promoting the activation of RAR and inhibiting the activity of PPAR/, SLCFA suppress the growth and oncogenic properties of FABP5-expressing carcinoma cells both in cultured cells and in vivo.
Saturated fatty acids regulate retinoic acid signalling and suppress tumorigenesis by targeting fatty acid-binding protein 5.
Cell line
View SamplesHere, we present a systematic and quantitative test of the hypothesis that the composition and activities of the endoplasmic reticulum (ER) proteostasis network impact mutational tolerance of secretory pathway client proteins. We focus on influenza hemagluttinin (HA), a viral coat protein that folds in the host's ER via a complex but well-characterized pathway. By integrating chemical methods to modulate the unfolded protein response with deep mutational scanning to assess mutational tolerance, we discover that upregulation of ER chaperones broadly enhances HA mutational tolerance across numerous sites and secondary/tertiary structure elements, including sites targeted by host antibodies. Remarkably, this host chaperone-enhanced mutational tolerance is observed at the same HA sites where mutational tolerance is most reduced by propagation at a fever-like temperature. Thus, host ER proteostasis mechanisms and temperature modulate HA mutational tolerance in opposite directions. This finding has important implications for influenza evolution, because influenza immune escape is contingent on HA possessing sufficient mutational tolerance to acquire antibody resistance while still maintaining the capacity to fold and function. More broadly, this work provides the first experimental evidence that the composition and activities of the ER proteostasis network critically define the mutational tolerance and, therefore, the evolution of secretory pathway client proteins. Overall design: RNA-seq characterizing a clonal HEK293T-Rex cell line, expressing DHFR ATF6f, Tet XBP1s, and the tetracycline repressor. These cell lines were treated with small molecules for 24 hours (in triplicate) to modulate the proteostasis environment in a stress-independent manner, at either 37C or 39C. XBP1s was activated by treatment with 0.1 ug/mL Doxycycline; ATF6f/XBP1s were activated by treatment with 0.1 ug/mL Doxycycline and 1 uM TMP; basal cells were vehicle-treated (0.01% DMSO). These cells were previously characterized in Shoulders et al. Cell Reports, 2013.
Enhanced ER proteostasis and temperature differentially impact the mutational tolerance of influenza hemagglutinin.
Specimen part, Cell line, Subject
View SamplesHeLa cells lacking MORC2 generated through CRISPR/Cas9-mediated gene disruption were reconstituted with either wild-type or R252W mutant MORC2, and re-repression of HUSH target genes assessed by RNA-seq Overall design: Total RNA-seq of MORC2 knockout cells, either 1) mock transduced, 2) transduced with lentiviral vector encoding wild-type MORC2 or 3) transduced with lentviral vector encoding R252W MORC2.
Hyperactivation of HUSH complex function by Charcot-Marie-Tooth disease mutation in MORC2.
Cell line, Subject
View SamplesOrgan transplant recipients (OTRs) on Cyclosporine A (CSA) are prone to catastrophic cutaneous squamous cell carcinoma (SCC). Allograft-sparing, cancer-targeting systemic treatments are unavailable. We have shown increased risk for catastrophic SCC in OTRs via CSA-mediated induction of Interleukin-22 (IL-22). Herein, we found CSA drives SCC proliferation and tumor growth through IL-22 and JAK/STAT pathway induction. We in turn inhibited SCC growth with an FDA-approved JAK 1/2 inhibitor, Ruxolitinib. In human SCC cells, greatest proliferative response to IL-22 and CSA treatment occurred in non-metastasizing lines. IL-22 treatment upregulated JAK1 and STAT1/3 in A431 SCC cells. JAK/STAT pathway genes were highly expressed in tumors from a cohort of CSA-exposed OTRs, and in SCC with high risk for metastasis. Compared to immunocompetent SCC, genes associated with innate immunity, response to DNA damage and p53 regulation were differentially expressed in SCC from OTRs. In nude mice engrafted with human A431 cells, IL-22 and CSA treatment increased tumor growth and upregulated IL-22 receptor, JAK1 and STAT 1/3 expression. Ruxolitinib treatment significantly reduced tumor volume and reversed the accelerated tumor growth. CSA and IL-22 exacerbate aggressive behavior in SCC. Targeting the IL-22 axis via selective JAK/STAT inhibition may reduce the progression of aggressive SCC in OTRs, without compromising immunosuppression.
Ruxolitinib inhibits cyclosporine-induced proliferation of cutaneous squamous cell carcinoma.
No sample metadata fields
View SamplesComparative analysis can provide important insights into complex biological systems. As demonstrated in the accompanying paper, Translating Ribosome Affinity Purification (TRAP), permits comprehensive studies of translated mRNAs in genetically defined cell populations following physiological perturbations.
Application of a translational profiling approach for the comparative analysis of CNS cell types.
No sample metadata fields
View SamplesWe developed a mouse line targeting midbrain dopamine neurons for Translating Ribosome Affinity Purification (TRAP). Here, we briefly report on the basic characterization of this mouse line including confirmation of expression of the transgene in midbrain dopamine neurons and validation of its effectiveness in capturing mRNA from these cells. We also report a translational profile of these neurons which may be of use to investigators studying the gene expression of these cells. Finally, we have donated the line to Jackson Laboratories for distribution and use in future studies.
Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.
Sex, Specimen part
View SamplesThe goal of the study was to analyze the principles governing the usage of alternatively spliced transcript isoform of four types of T-cells (Naïve, Central Memory, Transitional Memory and Effector Memory) between resting and activated status. However, the principles discovered in the T cells were universal and can also be applied to other cell type and tissues. Overall design: Four types of T cells were sorted and whole transcriptome analysis was performed using an Illumina machine The readme.txt contains the column headers and description for the processed data files.
Stochastic principles governing alternative splicing of RNA.
Subject
View SamplesBiological comparison of gene expression profiles of adult male whole Muta™Mouse lung with its immortalized 100% confluent epithelial lung cell line counterpart. White, P.A.,et al. 2003. Development and characterization of an epithelial cell line from Muta™Mouse lung. Environ Mol Mutagen 42,3 pgs 166-184
Comprehensive comparison of six microarray technologies.
Sex, Specimen part, Cell line, Subject
View Samples