Filters
Technology
Platform
Mus musculus
6 Downloadable Samples
Illumina HiSeq 2500
Description
Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-ß-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and –independent pathways Overall design: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500 genotype/variation: CYPKO: Sample 1,Sample 2,Sample 3 genotype/variation: G6PD: Sample 4,Sample 5,Sample 6 biological replicate: Sample 1,Sample 2,Sample 3 biological replicate: Sample 4,Sample 5,Sample 6
Publication Title
Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.
Sample Metadata Fields
Specimen part, Subject
View Samples- Populus tremula x populus alba
- 10 Downloadable Samples
Affymetrix Poplar Genome Array (poplar)
Description
Regeneration of transgenic cells remains a major obstacle to research and commercial deployment of transgenic plants for most species.
Publication Title
Genome scale transcriptome analysis of shoot organogenesis in Populus.
Sample Metadata Fields
Sex
View Samples- Homo sapiens
- 50 Downloadable Samples
- Affymetrix Human Genome U133A 2.0 Array (hgu133a2)
Description
Expression profile of human donor lungs that have developed primary graft dysfunction (PGD) after lung transplantation and those that have not.
Publication Title
Expression profiling of human donor lungs to understand primary graft dysfunction after lung transplantation.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 37 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Peripheral arterial disease (PAD) is a relatively common manifestation of systemic atherosclerosis that leads to progressive narrowing of the lumen of leg arteries. Circulating monocytes are in contact with the arterial wall and can serve as reporters of vascular pathology in the setting of PAD. We performed gene expression analysis of peripheral blood mononuclear cells (PBMC) in patients with PAD and controls without PAD to identify differentially regulated genes. We identified 87 genes differentially expressed in the setting of PAD; 40 genes were upregulated and 47 genes were downregulated. We employed an integrated bioinformatics pipeline coupled with literature curation to characterize the functional coherence of differentially regulated genes. Notably, upregulated genes mediate immune response, inflammation, apoptosis, stress response, phosphorylation, hemostasis, platelet activation and platelet aggregation. Downregulated genes included several genes from the zinc finger family that are involved in transcriptional regulation. These results provide insights into molecular mechanisms relevant to the pathophysiology of PAD.
Publication Title
Gene expression profiling of peripheral blood mononuclear cells in the setting of peripheral arterial disease.
Sample Metadata Fields
Specimen part, Disease, Disease stage
View Samples- Homo sapiens
- 30 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Gene expression profiling to determine transcriptome changes following Snail or Slug expression in MCF-7 breast cancer cells
Publication Title
The transcription factors Snail and Slug activate the transforming growth factor-beta signaling pathway in breast cancer.
Sample Metadata Fields
Cell line, Treatment
View Samples
SRP022904- Mus musculus
- 4 Downloadable Samples
- Illumina HiSeq 2000
Description
Small RNAs were deep sequenced from the liver and spleen of adult mice in an effort to identify somatic piRNAs. Following sequencing of all small RNAs, known non-coding RNAs were computationally removed from the dataset. The remaining RNAs were then mapped to the genome and analyzed for sequence characteristics (5'' base, length) typical of known piRNAs. To determine if any of the identified small RNAs were MIWI2 dependent, we deep sequenced small RNAs from liver and spleen of MIWI2 KO mice and analyzed them as above. Overall design: We deep sequenced small RNAs from the liver and spleen of one WT mouse and one MIWI2 knock-out mouse. We then trimmed sequencing adapters and removed known ncRNAs (rRNA, tRNA, snoRNA, snRNA, miRNA) from the dataset before aligning reads to the mm9 assembly of the mouse genome.
Publication Title
piRNA-like small RNAs mark extended 3'UTRs present in germ and somatic cells.
Sample Metadata Fields
Specimen part, Cell line, Subject
View Samples- Mus musculus
- 12 Downloadable Samples
- NextSeq 500
Description
RNA-sequencing was conducted to profile the transcriptome of the post-ischemic mouse cortex at multiple reperfusion time-points. RNA was isolated from sham and middle cerebral artery occlusion (MCAO)-operated mice at different reperfusion time points (6 h, 12 h or 24 h; three independent biological replicates per group), converted into cDNA libraries, and used for Illumina deep sequencing on a NexSeq500 instrument. The sequencing reads that passed quality filters were analyzed at the transcript isoform level based on the Tuxedo software package. On average 40.6 million reads were obtained from each sample and genome mapping was on average 82.9% for all samples. We detected 20,748 genes and 56,586 isoforms in the sham group; 22,192 genes and 60,023 isoforms in the 6 h group; 21,771 genes and 59,539 isoforms in the 12 h group; and 21,576 genes and 59,020 isoforms in the 24 h group. Our study represents the first detailed analysis of post-stroke mouse cortex transcriptomes generated using RNA-sequencing technology. Overall design: Genome-wide transcriptomic profiles of healthy and post-ischemic mouse cortices at various reperfusion time-points (6 h, 12 h, or 24 h) were generated using Illumina sequencing.
Publication Title
Deep Sequencing Reveals Uncharted Isoform Heterogeneity of the Protein-Coding Transcriptome in Cerebral Ischemia.
Sample Metadata Fields
Sex, Age, Specimen part, Cell line, Subject, Time
View Samples- Mus musculus
- 12 Downloadable Samples
- Illumina HiSeq 4000
Description
Purpose:We have the first-reported set of glial-specific transcripts utilizing the Ribotag model. We use this model to explore glial changes in DNBS-induced inflammation and neurokinin-2 receptor (NK2R) antagonism. Methods: Actively translated mRNA profiles of the distal colon myeneteric plexi of Rpl22(+/-)Sox10(+/-) male and female mice 8-10 weeks old were obtained utilizing the HA-tagged ribosomal immunoprecipitation and downstream RNA extraction. Samples meeting RNA quality standards by 18S and 28S rRNA peaks by 2100 Bioanalyzer and RNA 6000 Nano LabChip Kit (Agilent) were deep sequenced with the Illumina HiSeq 4000. Results: We mapped approximately 30-50 millions reads per sample to the mouse genome (v88) and identified approximately 100K ribosome-associated transcripts, with Tuxedo workflow, in distal colon glial cells with DNBS-induced inflammation and NK2R antagonism and their respective controls. Of these transcripts, changes in biological processes associated with inflammation and other important enteric nervous system communications between samples have been identified. Conclusions: Our study demonstrates the first use of the Ribotag model to provide glial cell-specific actively-translated mRNA changes in DNBS-induced inflammation with and without functional NK2R signalling. Overall design: Distal colon glial mRNA samples from Ribotag Rpl22(+/-)Sox10(+/-) mice administered either saline or DNBS and DMSO vehicle or NK2R antagonism.
Publication Title
Communication Between Enteric Neurons, Glia, and Nociceptors Underlies the Effects of Tachykinins on Neuroinflammation.
Sample Metadata Fields
Sex, Specimen part, Cell line, Subject
View Samples- Homo sapiens
- 9 Downloadable Samples
- Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
Aim was to identify cellular factors that regulate HPV-16 late gene expression at the level of RNA processing
Publication Title
Heterogeneous Nuclear Ribonucleoprotein C Proteins Interact with the Human Papillomavirus Type 16 (HPV16) Early 3'-Untranslated Region and Alleviate Suppression of HPV16 Late L1 mRNA Splicing.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Mus musculus
- 7 Downloadable Samples
- Affymetrix Mouse Genome 430A 2.0 Array (mouse430a2)
Description
Ragweed challenge in Ragweed (RWE) sensitized animals generates Reactive oxygen species (ROS) in the airway epithelium and induces allergic airway inflammation. We want to study the genes induced by ROS generated by RWE. This goal can be achieved by comparing PBS challenge vs. RWE challenge.
Publication Title
Allergen challenge induces Ifng dependent GTPases in the lungs as part of a Th1 transcriptome response in a murine model of allergic asthma.
Sample Metadata Fields
No sample metadata fields
View Samples