Filters
Technology
Platform
SRP074231
Mus musculus
6 Downloadable Samples
Illumina HiSeq 2500
Description
Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-ß-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and –independent pathways Overall design: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500 genotype/variation: CYPKO: Sample 1,Sample 2,Sample 3 genotype/variation: G6PD: Sample 4,Sample 5,Sample 6 biological replicate: Sample 1,Sample 2,Sample 3 biological replicate: Sample 4,Sample 5,Sample 6
Publication Title
Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.
Sample Metadata Fields
Specimen part, Subject
View Samples- Zea mays
- 29 Downloadable Samples
- Illumina HiSeq 2000
Description
Plants have developed complex mechanisms to respond and adapt to abiotic stresses, coupling elaborate modulation of gene expression together with the preservation of genome stability. Epigenetic mechanisms - DNA methylation, chromatin modifications and non coding RNAs - were shown to play a fundamental role in stress-induced gene regulation and may also result in genome destabilization, with the activation and/or the transcription of silenced transposons and retroelements, causing genome rearrangements and novel gene expression patterns. Maize leaf transcriptome was analyzed by total RNA-Seq in both B73 and rmr6 (PolIV mutant involved in siRNA biogenesis and in the RdDM pathway) after drought and salt stress application. Reference annotation based transcript assembly allowed the identification both of new expressed loci and splicing variants, improving the current maize transcriptome annotation. Many antisense transcripts matching on the opposite strand of annotated loci were also identified, while more than the 20% of transcripts represent non coding RNA belonging to four classes: siRNAs, shRNAs, lncRNAs and transposable elements (or their relics). Several lncRNAs are modulated by stress application while TE-related sequences are mainly expressed in rmr6 and up-regulated by the stress. Overall design: Total RNA-Seq analysis of maize leaves from wt and rmr6-1 mutant plants grown under 1) control conditions, 2) drought stress, 3) salt stress, 4) salt+drought stress. Each condition was investigated in triplicate after 10 days of treatment and after 7 days of recovery. Samples derived from replicates 2 and 3 were pooled and sequenced together
Publication Title
Maize RNA PolIV affects the expression of genes with nearby TE insertions and has a genome-wide repressive impact on transcription.
Sample Metadata Fields
Treatment, Subject, Time
View Samples- Mus musculus
- 2 Downloadable Samples
- Illumina HiSeq 2000
Description
The alimentary tract contains a diffuse endocrine system comprising enteroendocrine cells that secrete peptides or biogenic amines to regulate digestion, insulin secretion, food intake, and energy homeostasis. Lineage analysis in the stomach revealed that a significant fraction of endocrine cells in the gastric corpus did not arise from neurogenin3-expressing cells, unlike enteroendocrine cells elsewhere in the digestive tract. We aimed to isolate enriched serotonin-secreting and enterochromaffin-like (ECL) cells from the stomach and to clarify their cellular origin. We used Neurod1 and Neurog3 lineage analysis, and examined differentiation of serotonin-producing and ECL cells in stomach tissues of Neurod1-cre;ROSAtdTom, Tph1-CFP, c-Kitwsh/wsh, and Neurog3Cre;ROSAtdTom mice, by immunohistochemistry. We used fluorescence-activated cell sorting to isolate each cell type for gene expression analysis. We performed RNA-seq analysis of ECL cells. Neither serotonin-secreting nor ECL cells of the corpus arose from cells expressing Neurod1. Serotonin-secreting cells expressed a number of mast cell genes, but not genes associated with endocrine differentiation; they did not develop in c-Kitwsh/wsh mice and were labeled with transplanted bone marrow cells. RNA-seq analysis of ECL cells revealed high expression levels of many genes common to endocrine cells including transcription factors, hormones, ion channels, and solute transporters but not markers of bone marrow cells. Overall design: We used fluorescence-activated cell sorting to isolate Hdc+ cells from stomach corpus and performed RNA-seq for gene expression analysis to determine the origin of those cells.
Publication Title
Distinct cellular origins for serotonin-expressing and enterochromaffin-like cells in the gastric corpus.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 4 Downloadable Samples
- Illumina HiSeq 2000
Description
An inducible program of inflammatory gene expression is central to antimicrobial defenses. This response is controlled by a collaboration involving signal-dependent activation of transcription factors, transcriptional co-regulators, and chromatin-modifying factors. We have identified a long noncoding RNA (lncRNA) that acts as a key regulator of this inflammatory response. Pattern recognition receptors such as the Toll-like receptors induce the expression of numerous lncRNAs. One of these, lincRNA-Cox2, mediates both the activation and repression of distinct classes of immune genes. Transcriptional repression of target genes is dependent on interactions of lincRNA-Cox2 with heterogeneous nuclear ribonucleoprotein A/B and A2/B1. Collectively, these studies unveil a central role of lincRNA-Cox2 as a broad-acting regulatory component of the circuit that controls the inflammatory response Overall design: Examination of Mus musculus (C57BL/6 background) gene expression changes following stimulation with Pam3Cys4 in presence or absence of shRNA specifically targetting lncRNA-COX2
Publication Title
A long noncoding RNA mediates both activation and repression of immune response genes.
Sample Metadata Fields
Specimen part, Cell line, Subject
View Samples- Mus musculus
- 39 Downloadable Samples
- Illumina HiSeq 2000
Description
Purpose: Next-generation sequencing (NGS) provides for quantitation of RNA abundances and comparison of RNA abundances within tissues and cells in a manner not possible with previous microarray technologies. We have made widespread use of Illumina sequencing technologies for RNA quantitation in several publications involving mouse hearts, dating from 2010, and wish to share both high-quality raw sequencing data and data processed to quantitate mRNA abundances from wild-type mice, male and female, at a variety of ages. These data will provide a resource for investigators using microarrays to understand the concentration of transcripts of interest relative to other cardiac RNAs, and will permit deeper interpretation of previous microarray studies. Overall design: 39 cardiac small RNA (microRNA) profiles of 4- to 16 week-old FVB/NJ wild type (WT) mice were generated on Illumina HiSeq 2000 instruments.
Publication Title
Great Expectations: MicroRNA-30d and Cardiac Resynchronization Therapy.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 12 Downloadable Samples
- Illumina HiSeq 2500
Description
Adult mice bearing homozygous floxed Parkin alleles (PMIDs 15249681, 21376232; T M Dawson), with or without the Myh6-driven MERCreMER transgene, were administered tamoxifen at 6-10 wks of age. Tissues were obtained from euthanized mice 9-10 weeks after tamoxifen induction. Overall design: 6 floxed, non-Cre (noninduced) mouse hearts; 6 floxed, MERCreMer, adult-induced, Parkin knockout mouse hearts
Publication Title
Central Parkin: The evolving role of Parkin in the heart.
Sample Metadata Fields
Specimen part, Subject, Time
View Samples- Mus musculus
- 9 Downloadable Samples
- Illumina HiSeq 2500
Description
Dysfunctional Parkin-mediated mitophagic culling of senescent or damaged mitochondria is a major pathological process underlying Parkinson disease and a potential genetic mechanism of cardiomyopathy. Despite epidemiological associations between Parkinson disease and heart failure, the role of Parkin and mitophagic quality control in maintaining normal cardiac homeostasis is poorly understood.We used germline mutants and cardiac-specific RNA interference to interrogate Parkin regulation of cardiomyocyte mitochondria and examine functional crosstalk between mitophagy and mitochondrial dynamics in Drosophila heart tubes. Overall design: 5 wild-type mouse hearts; 4 germline Parkin knockout mouse hearts Please note that the mouse cardiac examples were an adjunct to the Drosophila studies that comprised most of the associated publication. However, mRNA-sequencing was only performed on the mouse samples, not the Drosophila heart tubes.
Publication Title
Central Parkin: The evolving role of Parkin in the heart.
Sample Metadata Fields
Specimen part, Subject
View Samples- Homo sapiens
- 24 Downloadable Samples
- Illumina HiSeq 2000
Description
Our studies indicate that glucose and acetate can regulate histone acetylation by altering the acetyl-CoA concentrations in the cell. The purpose of this study was to to determine whether specific gene sets correlated with acetyl-CoA availability. We conclude that 10% of glucose-regulated genes are acetyl-CoA regulated genes (genes suppressed or induced by low glucose and reversed by acetate). Acetate usually regulated gene expression in the same direction as glucose, suggesting that acetyl-CoA is a key mediator of glucose-dependent gene expression. Overall design: The experiments were performed in quadruplicates for each condition with a total of 12 samples
Publication Title
Akt-dependent metabolic reprogramming regulates tumor cell histone acetylation.
Sample Metadata Fields
Specimen part, Cell line, Subject
View Samples- Mus musculus
- 6 Downloadable Samples
- Illumina HiSeq 2000
Description
Purpose: Next-generation sequencing (NGS) provides for quantitation of RNA abundances and comparison of RNA abundances within tissues and cells in a manner not possible with previous microarray technologies. We have made widespread use of Illumina sequencing technologies for RNA quantitation in several publications involving mouse hearts, dating from 2010, and wish to share both high-quality raw sequencing data and data processed to quantitate mRNA abundances from wild-type mice, male and female, at a variety of ages. These data will provide a resource for investigators using microarrays to understand the concentration of transcripts of interest relative to other cardiac RNAs, and will permit deeper interpretation of previous microarray studies. Overall design: 6 cardiac small RNA (microRNA) profiles of 18 week-old C57BL/6J wild type (WT) mice were generated on Illumina HiSeq 2000 instruments.
Publication Title
Menage a Trois: intimate relationship among a microRNA, long noncoding RNA, and mRNA.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 4 Downloadable Samples
- Illumina HiSeq 2000
Description
Purpose: Next-generation sequencing (NGS) provides for quantitation of RNA abundances and comparison of RNA abundances within tissues and cells in a manner not possible with previous microarray technologies. We have made widespread use of Illumina sequencing technologies for RNA quantitation in several publications involving mouse hearts, dating from 2010, and wish to share both high-quality raw sequencing data and data processed to quantitate mRNA abundances from wild-type mice, male and female, at a variety of ages (see our FVB/NJ data submission). These data will provide a resource for investigators using microarrays to understand the concentration of transcripts of interest relative to other cardiac RNAs, and will permit deeper interpretation of previous microarray studies. Overall design: 4 cardiac polyA+-RNA profiles of 12 week-old C57BL/6J wild type (WT) mice were generated on Illumina HiSeq 2000 instruments.
Publication Title
Menage a Trois: intimate relationship among a microRNA, long noncoding RNA, and mRNA.
Sample Metadata Fields
No sample metadata fields
View Samples